ESTA PRACTICA LA ENCONTRARAS EN EL MENSAJE DE NAVIDAD 2001  QUE REINE LA VERDADERA PAZ.

 

POR: A,Z,F. V,M,K. TAWA MANU.

PRACTICA REGENERATIVA DEL INTER-ION

A) Filosofía introductiva


Como quiera que en el Mes de Marzo del año 2002 en realidad ingresaremos al Noveno de la Nueva Era Acuaria que es cuando se presentará de modo propicio un Equiflux Cósmico (Equilibrio armónico bio-magnético-psico-sexual) que viene siendo una expresión más adecuada para explicar lo que es un Jubileo Celestial, corro con el riesgo y asumo la delicada responsabilidad de plantear a quienes, ansiosos de iniciación cierta pero cansados de falacias y/o teorías vanas, y luego de que hayan aceptado los indubitables dones de la bien entendida Castidad Científica y estén practicando sus benéficos resultados, puedan acceder a una tangible comprobación contundente "Aquí y ahora".

Considero que quien esto lea y analice, no se esforzará en comprender la natural anatomía cartilaginosa del esternón que llevamos en el pecho uniendo las costillas que emergen de la Columna Vertebral, y en cuya cavidad llevamos físicamente por delante el corazón y el hígado, mientras que por atrás tenemos los pares de pulmones y riñones.

 
 Quienes siguiendo la esencia de mis anteriores Mensajes ya hubieran adelantado - en su día y en su hora precisa de cada mes - algo de las prácticas que mi Ser entrega con la intervención del Maestro Melkisedek para la reparación de corazón, hígado y riñones, de conformidad a lo que veladamente se aconseja en el Libro de Revelaciones o Apocalipsis de las Sagradas Escrituras, y en cuya constancia es posible lograrse verdaderos milagros de regeneración anímico celular, podrán comprobar sin sugestiones a priori, las maravillas que esta vez con el INTERION pueden operar los pulmones, habiendo sido habilitados para responder a los supremos impulsos de la Memoria Cósmica, recuperada la condición de procesar el Maná Celestial, esto es, las características etéricas contenidas en el oxígeno hidrogenado heliónicamente mediante el Sagrado Eroar.

Aclaro: mediante el esternón nuestra naturaleza orgánica está consignada a recibir los beneficios materiales que devienen del impulso respiratorio regular o semiconsciente, que permite a la vez la sabia combinación equilibrada del indispensable funcionalismo vegetativo del cuerpo, en cuyo resultado lógico puede otorgar al individuo común una salud abundante con toda la extraordinaria satisfacción que eso significa y que culmina en el verdadero deleite de vivir, esto es, recuperando la felicidad del Paraíso terrenal, irguiéndose nuevamente como Hombre en la escala evolutiva por encima de la condición meramente animal.

Otra cosa supremamente superior es poder vencer la fatalidad de los estigmas del pecado que ha llevado por eones a los hombres de barro a soportar la aparente insalvable situación de necesidad material, constreñidos al parto doloroso, el hambre, la enfermedad y la muerte, anatemas que persisten en los alicaídos descendientes de Adán y Eva que conformamos las humanidades del inconmensurable espacio existente por debajo de la cuarta coordenada dimensional.

Por si todavía no ha sido advertido por los investigadores serios, y a fin de premiar su dedicación y búsqueda sincera, debo enfatizar que la naturaleza tridimensional alberga lo que vendría en denominarse el Paraíso terrenal que corresponde a las especies que mantienen su original inocencia, libres de todo pecado, aunque sin poder acceder a las escalas de la Divinidad, esto es, sin llegar a disfrutar los encantos del Arbol de la Vida mediante el cual se permite a los intrépidos superar la mera creación material.

 



B) Preparativos para la práctica

 
 A)


 El Interion se divide en tres partes y una síntesis o Jubileo; una es positiva y masculina, operando con la Runa Inti; otra es negativa y femenina procesando la Runa Inkaos, la tercera es mixta y se ejecuta con la Runa Gibur, mientras que la Obra se sella con la Runa Krisol que es el Equiflux constituyendo la fusión de lo Humano con lo Divino, o como se llama en Lenguaje Divino al Sagrado Tetragrama: Kona-Tiki Wira-Kocha o IEVE como se le conoce entre quienes pretenden encarnarle y que aún no han adquirido la dignidad de invocarle y ver TAL COMO ES. 

La pareja laborante requiere disponer de un ambiente más o menos espacioso, sea cubierto o despejado para llevar a efecto esta práctica.

B)

Ambos participantes deben de encontrarse preferentemente en ayunas.

C)

Es recomendable que previamente hubiesen orado y meditado juntos.

D)

Hay que tener preparado un pequeño Altar, que se halle libre de la curiosidad de extraños.

E)

Sobre el Ara deben estar dos candeleros conteniendo cada uno tres cirios encendidos y las Sagradas Escrituras o Pistis Sofía, o mejor ambas.

F)

Espada en mano El y con un Cáliz conteniendo Agua sin químicos Ella, dirán al unísono:

 

Por la Gloria del Señor Jehová, Invocamos las Potencias del Altísimo para conjurar y alejar de aquí todo mal. ITABABO HÁGASE LUZ. QUE ASÍ SEA.

 

G)

Luego hay que mentalizar una Cruz o un trébol de cuatro hojas o un doble ocho dispuesto horizontal y verticalmente partiendo desde el punto central.

 

H)

El Interion se divide en tres partes y una síntesis o Jubileo; una es positiva y masculina, operando con la Runa Inti; otra es negativa y femenina procesando la Runa Inkaos, la tercera es mixta y se ejecuta con la Runa Gibur, mientras que la Obra se sella con la Runa Krisol que es el Equiflux constituyendo la fusión de lo Humano con lo Divino, o como se llama en Lenguaje Divino al Sagrado Tetragrama: Kona-Tiki Wira-Kocha o IEVE como se le conoce entre quienes pretenden encarnarle y que aún no han adquirido la dignidad de invocarle y ver TAL COMO ES.


 

C) El "Modus operandi"


 

C1)

 
 
La postura del hombre en la Runa INTI, es inclinarse casi de cuclillas extendiendo las manos hacia arriba, permitiendo que la mujer suba sobre sus hombros, agarrando aquél las manos de su pareja e irguiéndose ambos para lentamente ejecutar la respectiva Runa, comenzando con el pie izquierdo y la mano derecha de EL, llevando a cabo la Cruz en Movimiento o Cruz de Andrés a modo de pausada caminata con leve balanceo de las manos hacia adelante y atrás, tal como procedían en la Antigua Arkadía los Sacerdotes Tiahuanakotas , Mayas y Aztecas entre otros Grandes Iniciados de la Antigüedad. 

Con lúcida imaginación y concentración plena, realizarán ambos el Trébol Viviente en su primer pétalo partiendo del centro hacia arriba o el Norte, a la vez que por cuatro veces mantralizan así: IIIIIIIIINNNNNNNNN TTTTTTTTTIIIIIIIII.

 

C2)

Con el mismo procedimiento, pero esta vez con la Runa INKAOS, es la mujer quien lleva en hombros a su pareja y empezando del centro hacia abajo o el Sur, con el pie derecho y la mano izquierda, iniciarán el segundo paso soltando suavemente por cuatro veces el Mantra IIIIIIIIINNNNNNNNN KKKKKKKKKAAAAAAAAA OOOOOOOOOSSSSSSSSS cerrando el pétalo nuevamente en el centro.

C3)

De igual modo como se procedió antes, pero volviendo el hombre a llevar a la mujer, la Runa GIBUR empieza con el pie derecho y la mano izquierda, iniciándose el tercer paso desde el centro hacia la derecha o el Este, diciendo por cuatro veces GGGGGGGGGIIIIIIIII BBBBBBBBBUUUUUUUUURRRRRRRRR, hasta que retornan al centro de la Mística Flor.

C4

) Se finaliza esta secuencia volviendo la mujer a levantar al hombre esta vez con la Runa KRISOL, dando inicio al Equiflux con el pie izquierdo y la mano derecha, partiendo del centro hacia la izquierda diciendo cuatro veces el Mantra KKKKKKKKKRRRRRRRRRIIIIIIIII SSSSSSSSSOOOOOOOOOLLLLLLLLL hasta llegar nuevamente al centro.

C5)

Erguidos ambos se dirigen al pequeño Altar para beber alternativamente el Agua contenida en el Cáliz, luego de lo cual, apagan las velas y levantan el Altar.

C6)

Dentro de los siguientes veinte minutos deben proceder a ducharse, si posible con agua fría.

C7)

Viviendo el más completo Amor y la más grande pureza, la pareja llega al deleite del supremo Eroar, concentrados en los pulmones desbaratando con imaginación creadora todo antiguo o reciente recuerdo de guerra, odio, ira, pleito, controversia, antipatía o enemistad, mantralizando: SSSSSSSSSOOOOOOOOOLLLLLLLLL VVVVVVVVVEEEEEEEEE.

C8)

Ahora la imaginación consciente se concentra en el Corazón para decretar con el Mantra CCCCCCCCCOOOOOOOOO AAAAAAAAAGGGGGGGGGUUUUUUUUU AAAAAAAAALLLLLLLLL el Renacimiento o la Paz Espiritual con el advenimiento del Amor, la Armonía, la Dulzura, la Simpatía, la Amistad, virtudes que entre muchas otras se ven refulgir triunfantes desde nuestra Naturaleza Kristificada.

C9)

Aún conectados en la Alkimia con el Sagrado Eroar, oran a la Madre Divina, visualizando la irradiación luminosa y la deliciosa fragancia perfumada que emanan del Manto de la Purísima particularizada en el Original Andrógino así renacido, aunque uniendo este fulgor al brillo singular de la Patrona de México, la clementísima Virgen Guadalupana, vigorizando la concentración consciente al enviar este Esplendor de Paz en favor de todos los estantes y habitantes de esta nuestra Madre Tierra, para que sin distinción de raza, sexo, edad, cultura, doctrina o condición social, de este singular modo recuperemos el verdadero sentido de la Navidad que nos legó el Adorable Salvador Jesús El Kristo, cuyo espíritu dimana triunfal la auténtica comunión y universalidad entre todas las especies de la Creación.
 
  

D) La secuencia regeneradora


Esta práctica debe ejecutarse en pareja constituida legítimamente los días 9 a horas 9 a.m. durante nueve meses sin soltar ni una sola vez por encima de cualquier otra obligación o tarea existente, comenzando según el calendario gregoriano en el mes de Marzo que corresponde al primero y concluyendo en Noviembre que en realidad es el noveno mes de la secuencia correcta del calendario Soli-lunar que consta de trece períodos o lunaciones y que para entonces estará en su Noveno Año.

 

 


GRAN CAUDAL DE SABIDURIA.

“¡Qué gran caudal de sabiduría
arrastraron tus aguas sagradas, Padre Nilo, a través de los milenios, tú, que
recogiste el mejor fruto, la mejor herencia del remoto pasado!”. ¡Al derramarte
en el Mediterráneo, animarás y fomentarás otras civilizaciones!”.
FELIZ VIVE EN SU ESPLENDOR

¡Feliz vive en Su Esplendor!

Si la muerte el alma acongoja
del desvalido pecador,
el temor de sí despoja
quien renace en el Señor.

Pecado, vicio, inmundicias,
no hallan ya jamás cabida
en quien goza las delicias
de nueva iluminada Vida.

Morir, Nacer, Realizarse
para cumplir la Misión,
es la forma de librarse
de Yavé y su vil prisión.

Por el Kristo Resurrecto
acabóse ya el dolor;
¡Tú eres hoy un Ser Selecto
feliz vive en Su Esplendor!

=> ¿Desea una página web gratis? Pues, haz clic aquí! <=